Instant understanding
Detect whether a sequence is DNA, RNA, or protein and get useful stats, transformations, and pattern highlights in seconds.
Interactive sequence analysis
Explore the language of life
Paste a DNA, RNA, or protein sequence and see what it reveals — with instant analysis, visual fingerprints, translation, motif detection, and plain-English interpretation.
Live preview
DNA detected
ATGCGTACGTTGACCTGAATGGCCATGCTAGGCTAA
Length
37
GC content
51.4%
ORFs
2
This sequence looks like DNA with moderate GC content and at least one plausible coding region.
Why Biostrings
Built to make biological sequences understandable
Visual by design
See sequence fingerprints, composition patterns, ORFs, repeats, and motif signals through modern interactive visuals.
Built to teach
Every result is paired with plain-English interpretation so the analysis means something beyond raw numbers.
Signature output
Every sequence gets a visual identity
Biostrings turns raw biological strings into sequence fingerprints: visual summaries based on composition, complexity, repeats, and coding patterns.
DNA fingerprint
Composition waves, repeat density, and ORF markers in a blue-green palette.
RNA profile
Transcription-ready summaries with codon-aware patterning and translation preview.
Protein map
Amino acid class balance, residue patterns, and low-complexity signals.
Sequence library
Start with sequences that matter
Curated examples that are biologically important and easy to explore.
Human insulin
One of the most recognizable therapeutic proteins in biology and medicine.
GFP
The fluorescent protein that changed biological imaging forever.
Hemoglobin beta
A classic example for mutation, inheritance, and protein function.
CRISPR guide example
A compact sequence ideal for teaching targeting and complementarity.
Learning hub
Learn sequence biology without the wall of jargon
DNA vs RNA vs protein
Understand the differences between biological sequence types and how they relate to information flow in cells.
Reading frames and translation
See how nucleotides become codons, and how codons become amino acid sequences.
Start exploring
Paste a sequence and see what it says
Biostrings is designed for learners, educators, and researchers who want a clearer way to read biological data.